| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.055518 |
| Chromosome: | chromosome 1 |
| Location: | 5533055 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g039200 | FAP9,Rabl5,IFT22 | (1 of 1) K07935 - Rab-like protein 5 (RABL5); Intraflagellar transport protein 22 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCTGCACTTGAATGGCCATGACCATGCA |
| Internal bar code: | GTGTCCTGGCGATCACCTGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 713 |
| LEAP-Seq percent confirming: | 99.4805 |
| LEAP-Seq n confirming: | 1532 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGAGACGACTTGCGATTA |
| Suggested primer 2: | CTCAGAGGACTGGGAAGACG |