Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.055559 |
Chromosome: | chromosome 16 |
Location: | 5993832 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676600 | (1 of 4) IPR029041 - FAD-linked oxidoreductase-like | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATCACCCTGCGTTTGACGCAACACGTCA |
Internal bar code: | CCGTCATTCTCGGGTGGAGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 133 |
LEAP-Seq percent confirming: | 9.19701 |
LEAP-Seq n confirming: | 197 |
LEAP-Seq n nonconfirming: | 1945 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCTCACAACGAGAAGTGG |
Suggested primer 2: | GCTCTGTCCTTCTTGGATGC |