Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.055635 |
Chromosome: | chromosome 6 |
Location: | 2067123 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g264850 | (1 of 1) PTHR33820//PTHR33820:SF2 - FAMILY NOT NAMED // COILED-COIL DOMAIN-CONTAINING PROTEIN 17 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGCGATTACGAGCCAGAAAGCGAAGAAA |
Internal bar code: | TCCCGGCTGTCTACCCTGCGAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 298 |
LEAP-Seq percent confirming: | 99.0847 |
LEAP-Seq n confirming: | 866 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTTGTGACGGTGACATTGG |
Suggested primer 2: | AGACAGGTGGTGGGAAACTG |