| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.055689 |
| Chromosome: | chromosome 6 |
| Location: | 3921994 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278185 | UGD2 | UDP-glucose dehydrogenase; (1 of 3) 1.1.1.22 - UDP-glucose 6-dehydrogenase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTTTTGCACCAGTCACCTGCAAATCTGC |
| Internal bar code: | CGCCCAAAGCATCAGGAGGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 689 |
| LEAP-Seq percent confirming: | 99.0298 |
| LEAP-Seq n confirming: | 1429 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGCATAGTTTGGGGCAGTT |
| Suggested primer 2: | CTGCAGGTACCAGGTGGTTT |