| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.055732 |
| Chromosome: | chromosome 6 |
| Location: | 2239413 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g266383 | HEL26 | (1 of 1) K18995 - ATP-dependent RNA helicase DHX29 [EC:3.6.4.13] (DHX29); DEAD/DEAH box helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGTATACCACCAGTTTGGTAGTTTAGCG |
| Internal bar code: | CCAAGCGTTGGTGCGAGACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 385 |
| LEAP-Seq percent confirming: | 12.3059 |
| LEAP-Seq n confirming: | 840 |
| LEAP-Seq n nonconfirming: | 5986 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTCGGTTTAACGGATTGC |
| Suggested primer 2: | AAAAGCGTGAGAAGCATCGT |