| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.055785 |
| Chromosome: | chromosome 6 |
| Location: | 6002011 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g289150 | MTP5 | Metal Transport Protein 5; (1 of 1) K14696 - solute carrier family 30 (zinc transporter), member 9 (SLC30A9, ZNT9) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACCCACCCGCAGCATCCGCTCCGCTCCC |
| Internal bar code: | TAGTATAGGCAAAACGGTTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1336 |
| LEAP-Seq percent confirming: | 99.6038 |
| LEAP-Seq n confirming: | 4525 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTGCAGCAGATCAGTCAT |
| Suggested primer 2: | GCACAGCATGTCCTAAAGCA |