Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.055794 |
Chromosome: | chromosome 17 |
Location: | 744315 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g701250 | FLA12,PF8,CCDC39,FAP59 | Flagellar Associated Protein 59; (1 of 1) PTHR18962//PTHR18962:SF0 - FAMILY NOT NAMED // COILED-COIL DOMAIN-CONTAINING PROTEIN 39 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCCCCTCCCTCGCTGCGTCCCTCTCCCT |
Internal bar code: | CGGTAAATCGCTTTCCCCCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 46 |
LEAP-Seq percent confirming: | 86.4078 |
LEAP-Seq n confirming: | 89 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGTAGGAGGCTGCGAAGTT |
Suggested primer 2: | AGCGTGTGGACACTAATCCC |