| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.055865 |
| Chromosome: | chromosome 10 |
| Location: | 1455489 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g428650 | CDPKK1,CDPKKK1 | (1 of 3) K07359 - calcium/calmodulin-dependent protein kinase kinase (CAMKK); Calcium/calmodulin-dependent protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAACAGGGCAAAGACGGATGGGCGCATG |
| Internal bar code: | CGGGATATGTCACGTCGTAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 480 |
| LEAP-Seq percent confirming: | 99.6571 |
| LEAP-Seq n confirming: | 1744 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCTACGCAATAATGCAGC |
| Suggested primer 2: | ACCCACTTGACCAGGATGTC |