| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.055924 |
| Chromosome: | chromosome 1 |
| Location: | 2602003 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g015103 | Solute-binding protein-like adenylate cyclase; (1 of 7) PF00211//PF13416 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Bacterial extracellular solute-binding protein (SBP_bac_8) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCAGACGCAGCGCCACTGGCGTAACTCA |
| Internal bar code: | GGTCGGCTCGCTAGGTGATTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 677 |
| LEAP-Seq percent confirming: | 96.2063 |
| LEAP-Seq n confirming: | 2891 |
| LEAP-Seq n nonconfirming: | 114 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATCGGCACCGTAAATGAG |
| Suggested primer 2: | TCACTTTCATGCAGTAGCCG |