Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.056091 |
Chromosome: | chromosome 13 |
Location: | 618251 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g565750 | EFG4 | (1 of 1) K14416 - elongation factor 1 alpha-like protein (HBS1); Translation elongation factor Tu family protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGACTGAGGTCAGCCGCTCATACTCGTA |
Internal bar code: | TCGAGGGCCTTCTTTGGGCATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 832 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 468 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCTAGCTCGGAATGTGCCT |
Suggested primer 2: | AGCCCATTCCAGTTTGACAC |