| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.056112 |
| Chromosome: | chromosome 16 |
| Location: | 284135 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g694201 | (1 of 1) PTHR12461//PTHR12461:SF46 - HYPOXIA-INDUCIBLE FACTOR 1 ALPHA INHIBITOR-RELATED // SUBFAMILY NOT NAMED; Cupin- Jumonji-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTGGAGGTCAAAGGGGTTATTGCGCGCGA |
| Internal bar code: | GATCTTTACTAAAGAATATGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 644 |
| LEAP-Seq percent confirming: | 99.4537 |
| LEAP-Seq n confirming: | 11652 |
| LEAP-Seq n nonconfirming: | 64 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTATCACAGAGCAACGCGAC |
| Suggested primer 2: | ACTTCAATGCACACACCCAA |