| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.056319 |
| Chromosome: | chromosome 4 |
| Location: | 1138486 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g215950 | CYN57 | Cyclophilin 57; (1 of 1) K12737 - peptidyl-prolyl cis-trans isomerase SDCCAG10 [EC:5.2.1.8] (SDCCAG10) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGACGCTCTAACTGTACTTTTTAAGCACA |
| Internal bar code: | GCGCTAAGACAGGAGTGTAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 874 |
| LEAP-Seq percent confirming: | 99.4612 |
| LEAP-Seq n confirming: | 2769 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGCATTAACTGCGCTTTTT |
| Suggested primer 2: | CTGCAAGAGTGAGTAGGCCC |