| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.056331 |
| Chromosome: | chromosome 16 |
| Location: | 642519 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g691900 | PUS19 | RNA pseudouridine synthase; (1 of 1) PTHR11142:SF9 - TRNA PSEUDOURIDINE SYNTHASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCCAACTCCCAACCGCTCAACTTCCAA |
| Internal bar code: | TGTTTTCACTCGTTCTGGGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 284 |
| LEAP-Seq percent confirming: | 98.773 |
| LEAP-Seq n confirming: | 161 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGTGATCTTTTTCCCCTGC |
| Suggested primer 2: | CAGGAGCATGGGATGAAGAT |