| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.056334 |
| Chromosome: | chromosome 17 |
| Location: | 6094269 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g741350 | KIN7-4,KIN7D | Kinesin motor protein; (1 of 4) K11498 - centromeric protein E (CENPE) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAGAGCCACAACACGGTACGCGCTTGGA |
| Internal bar code: | TGTGCGCGCCTTCGCGTGTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 352 |
| LEAP-Seq percent confirming: | 58.9573 |
| LEAP-Seq n confirming: | 6842 |
| LEAP-Seq n nonconfirming: | 4763 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCTCAAATGATCCCACACT |
| Suggested primer 2: | CCCAAACACACACACACACA |