| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.056381 |
| Chromosome: | chromosome 15 |
| Location: | 248985 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g640800 | (1 of 1) PF15963 - Myb DNA-binding like (Myb_DNA-bind_7) | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGCAAAAAAGCCAGACCCAACGCCCCG |
| Internal bar code: | GCAAAGGGCGTGCTCACTATAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 725 |
| LEAP-Seq percent confirming: | 98.0936 |
| LEAP-Seq n confirming: | 1132 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGGATGTAGGTAGGGGGC |
| Suggested primer 2: | GCTCCTGACCTCCTCCTCTT |