| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.056442 |
| Chromosome: | chromosome 2 |
| Location: | 2779479 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g094150 | HIK,HIK2,HKR2 | (1 of 1) K12130 - pseudo-response regulator 5 (PRR5); Response regulator of two-component system | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GATGGTGCCGCAGCGCTCAAAGTCCTGGCT |
| Internal bar code: | CCGCGGCTGGTAATTAGTCAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 611 |
| LEAP-Seq percent confirming: | 99.6359 |
| LEAP-Seq n confirming: | 821 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGTTGCAAGCTCATTTTT |
| Suggested primer 2: | CATCACCAGTCATCACCGTC |