| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.056516 |
| Chromosome: | chromosome 12 |
| Location: | 3850068 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g515450 | UBC22 | (1 of 2) K10573 - ubiquitin-conjugating enzyme E2 A (UBE2A, UBC2, RAD6A); E2 Ubiquitin conjugating enzyme | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGATAACCCGCGGAAGCGTCATCAGTCCA |
| Internal bar code: | GGACGCCGCGCCTGCATGTCTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 929 |
| LEAP-Seq percent confirming: | 95.5631 |
| LEAP-Seq n confirming: | 3360 |
| LEAP-Seq n nonconfirming: | 156 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGGCGACTTTTAGCCTGA |
| Suggested primer 2: | TTAGTTCGTGCAGGATGCAG |