| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.056574 |
| Chromosome: | chromosome 1 |
| Location: | 1979521 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g010700 | SYP2 | Endosomal Qa-SNARE protein, Syntaxin7/Syx7/Pep12/Syp2-family (Qa.III.b); (1 of 1) PF14523 - Syntaxin-like protein (Syntaxin_2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAACGTTGCGGCCCAACGCCCCCTTGGAC |
| Internal bar code: | GCAGAACGTATAACTATAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 567 |
| LEAP-Seq percent confirming: | 99.6785 |
| LEAP-Seq n confirming: | 930 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGCATTCGGTTTGGTTTA |
| Suggested primer 2: | TCCTTTTCGGTCATGTAGGG |