| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.056726 |
| Chromosome: | chromosome 5 |
| Location: | 3316852 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g240400 | SOM2 | (1 of 2) PTHR11746//PTHR11746:SF104 - O-METHYLTRANSFERASE // O-METHYLTRANSFERASE 10; S-adenosyl-L-methionine-dependent O-methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGAACTCTTGCCGTACGACTACGCCTGCA |
| Internal bar code: | GTGTCGTGAGCTAGTAATAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 211 |
| LEAP-Seq percent confirming: | 99.3273 |
| LEAP-Seq n confirming: | 2510 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCAGAGAGATGGAGACAG |
| Suggested primer 2: | CCCTCCTCACACACACACAC |