Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.056726 |
Chromosome: | chromosome 5 |
Location: | 3316862 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g240400 | SOM2 | (1 of 2) PTHR11746//PTHR11746:SF104 - O-METHYLTRANSFERASE // O-METHYLTRANSFERASE 10; S-adenosyl-L-methionine-dependent O-methyltransferase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTGAAAACAAAAGGCACTAACCCTAACT |
Internal bar code: | ACTACCGCTTGACAGTTTGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 801 |
LEAP-Seq percent confirming: | 99.6384 |
LEAP-Seq n confirming: | 16256 |
LEAP-Seq n nonconfirming: | 59 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGCAGAGAGATGGAGACAG |
Suggested primer 2: | CCCTCCTCACACACACACAC |