Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.056818 |
Chromosome: | chromosome 8 |
Location: | 424658 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g358580 | CMPL1,CMP1 | Carbamoyl phosphate synthase, large subunit; (1 of 1) K01955 - carbamoyl-phosphate synthase large subunit (carB, CPA2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTCACCTCCCCTCCCCTCCCCTCACCGCT |
Internal bar code: | CGGAAAAGGGGGGACCGGCGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 477 |
LEAP-Seq percent confirming: | 99.4865 |
LEAP-Seq n confirming: | 775 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAGCCACAGGGCTCTTGTTC |
Suggested primer 2: | CCTCTCCCCGTTCCTCTATC |