| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.056903 |
| Chromosome: | chromosome 12 |
| Location: | 3095528 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g500150 | ALDH2E1,ALD5,ALDH2 | (1 of 1) K00128 - aldehyde dehydrogenase (NAD+) (E1.2.1.3); Aldehyde dehydrogenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAATGCGCTGCGGCGTTGGGGTGGGCTG |
| Internal bar code: | TCATCTTGCCAGACCATATCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 695 |
| LEAP-Seq percent confirming: | 62.5 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCTGGAGACACTGGACAA |
| Suggested primer 2: | GGAGTGGGAAGCAAGTGTGT |