Insertion junction: LMJ.RY0402.056905_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.056905
Chromosome:chromosome_7
Location:1376002
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre07.g322550 FAP240 Flagellar Associated Protein antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):GCCCTGCATCAATGCTTTGCGTCCTCTCCG
Internal bar code:CTGTCGTCGCGATGTAGGGGCG

Confirmation - LEAP-Seq

LEAP-Seq distance:787
LEAP-Seq percent confirming:99.3645
LEAP-Seq n confirming:4534
LEAP-Seq n nonconfirming:29
LEAP-Seq n unique pos:21

Suggested primers for confirmation by PCR

Suggested primer 1:TTTTCGGGCTTTATCGATTG
Suggested primer 2:GAGAACTTGACTTGCCTCGG