| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.056924 |
| Chromosome: | chromosome 1 |
| Location: | 4500900 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g030650 | PHR5,CRY-DASH2,DCRY2 | (1 of 3) K01669 - deoxyribodipyrimidine photo-lyase [EC:4.1.99.3] (phrB); DASH-type Cryptochrome 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGCCTTGCATGCCTTGGCCTCAAGTCC |
| Internal bar code: | GTTGTATCGATTTCTGGGATAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1302 |
| LEAP-Seq percent confirming: | 98.6207 |
| LEAP-Seq n confirming: | 429 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTGCCTTCCATGAACACT |
| Suggested primer 2: | TGGACAGCAGTACCAAGCTG |