Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.056984 |
Chromosome: | chromosome 5 |
Location: | 2946031 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g238260 | (1 of 1) PF13371//PF13414//PF13432 - Tetratricopeptide repeat (TPR_9) // TPR repeat (TPR_11) // Tetratricopeptide repeat (TPR_16) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTTACAACCCCCCGCACCTCCCGCACCTC |
Internal bar code: | CGGTGGCCATCCCCCCGTCAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 199 |
LEAP-Seq percent confirming: | 98.5816 |
LEAP-Seq n confirming: | 14178 |
LEAP-Seq n nonconfirming: | 204 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTAGATACCAGCCCAAACGG |
Suggested primer 2: | CATCTTTGCCCTCCTTCGTA |