Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.057056 |
Chromosome: | chromosome 2 |
Location: | 2731492 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g093700 | (1 of 1) K14951 - cation-transporting ATPase 13A3/4/5 (ATP13A3_4_5) | intron|outside_mRNA |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACTAGCCGTGCTAAGCCTTACTTGCGAG |
Internal bar code: | GAAGGCTCGCACCCTGGTCGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1224 |
LEAP-Seq percent confirming: | 99.6993 |
LEAP-Seq n confirming: | 14589 |
LEAP-Seq n nonconfirming: | 44 |
LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAAACCTGCAAGAGGAAGCA |
Suggested primer 2: | ACAGTAGCGGAGAGAGCAGC |