| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.057157 |
| Chromosome: | chromosome 3 |
| Location: | 4148581 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g173550 | (1 of 2) PTHR35100//PTHR35100:SF1 - FAMILY NOT NAMED // F15H11.13 PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAACTCACCGCGCGGGCTCAAAGCCGCCTG |
| Internal bar code: | CGTGATTTAAGGCTTATTGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1028 |
| LEAP-Seq percent confirming: | 99.1674 |
| LEAP-Seq n confirming: | 2382 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCAACATGCGTCAAAACT |
| Suggested primer 2: | GATGTACATGAGGAGGGCGT |