| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.057179 |
| Chromosome: | chromosome 7 |
| Location: | 1174992 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g320800 | (1 of 1) PF09468 - Ydr279p protein family (RNase H2 complex component) (RNase_H2-Ydr279) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTACTTCTTTGTAAAGAAGGAAGTCAGCT |
| Internal bar code: | GGTACTTCGTGTCGCACGCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 508 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCTACTACCGCCTGAACGA |
| Suggested primer 2: | ATGCCACCAACTACATGCAA |