| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.057193 |
| Chromosome: | chromosome 17 |
| Location: | 2967433 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g720150 | (1 of 1) IPR000104//IPR008752 - Antifreeze protein, type I // Peptidase M11, gametolysin | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACAACAGCTCCTCAAGTTCCTGAAGCGCA |
| Internal bar code: | TGCCCCGACGCGATGACATGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 346 |
| LEAP-Seq percent confirming: | 98.4848 |
| LEAP-Seq n confirming: | 975 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCGTTCACGGACTTCCC |
| Suggested primer 2: | CCCAGCTCGTGTAGGTAGGA |