| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.057243 |
| Chromosome: | chromosome 3 |
| Location: | 2038521 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g156250 | FAP186,POC13 | Proteome of centriole protein 13; (1 of 5) PF04366 - Las17-binding protein actin regulator (Ysc84) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTGAGCATGGGCGCAGTGCGGGGCCGTA |
| Internal bar code: | TTCTGTGCTGGAGCTGGCCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1101 |
| LEAP-Seq percent confirming: | 99.1438 |
| LEAP-Seq n confirming: | 2779 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGGTGACTTCTTTCTCTG |
| Suggested primer 2: | ACTTGAACCTCAATGGGTCG |