| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.057384 |
| Chromosome: | chromosome 2 |
| Location: | 7237231 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g145850 | FAP112 | Flagellar Associated Protein 112; (1 of 3) IPR006130 - Aspartate/ornithine carbamoyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTATGCGCGCGGCTGGTGCCCTGCCTACA |
| Internal bar code: | GCGTGGTGCTAAAAAATGGGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 236 |
| LEAP-Seq percent confirming: | 97.4054 |
| LEAP-Seq n confirming: | 901 |
| LEAP-Seq n nonconfirming: | 24 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGAAGGCACGCTAGTACC |
| Suggested primer 2: | TTCCACTCCACGACACCATA |