| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.057503 |
| Chromosome: | chromosome 17 |
| Location: | 6613889 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g743647 | (1 of 32) IPR029062 - Class I glutamine amidotransferase-like | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTCATCGCCCACCCCGCCTGAAACCTCCT |
| Internal bar code: | CGGGATCGGCAACAGCAGCTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 618 |
| LEAP-Seq percent confirming: | 97.6942 |
| LEAP-Seq n confirming: | 805 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCAGCAATCTGTCACTGGC |
| Suggested primer 2: | ACTTTGGTTAGGCATCACGG |