| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.057526 |
| Chromosome: | chromosome 7 |
| Location: | 1781534 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325721 | (1 of 1) PTHR34776:SF1 - F17F16.3 PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAAACCAAGCCAAGGGGGGTGTAATGAT |
| Internal bar code: | GCAGTGTCTCCCGATGGTAACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 900 |
| LEAP-Seq percent confirming: | 97.1829 |
| LEAP-Seq n confirming: | 56576 |
| LEAP-Seq n nonconfirming: | 1640 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCTTTAGCGTCTGTTGCT |
| Suggested primer 2: | GTCAAAACCCACGTCAAACC |