Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.057552 |
Chromosome: | chromosome 13 |
Location: | 911422 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g567800 | PPP41,PP2A2 | (1 of 1) K11584 - serine/threonine-protein phosphatase 2A regulatory subunit B' (PPP2R5); Protein phosphatase 2A regulatory B subunit | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGAAGGGACAGTCCGACAAGCACTCCGG |
Internal bar code: | AACATCCGTCTGGCCTAACTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 790 |
LEAP-Seq percent confirming: | 99.7718 |
LEAP-Seq n confirming: | 8307 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTAAATGCGCAGCCTTGTT |
Suggested primer 2: | TGTGGTGTGGTAGCTCGTGT |