Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.057661 |
Chromosome: | chromosome 16 |
Location: | 3102407 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g665450 | RYR1,FAP48 | Ryanodine-inositol 1%252C4%252C5-triphosphate receptor Ca2+ channel; (1 of 1) K04958 - inositol 1,4,5-triphosphate receptor type 1 (ITPR1) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACATCCTGCAGAGTTGAGGGCGAGGACGC |
Internal bar code: | TTGGCTGCAGTACGCAGGGCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 872 |
LEAP-Seq percent confirming: | 99.4302 |
LEAP-Seq n confirming: | 2094 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCAGAACTTGCCATTGGTC |
Suggested primer 2: | ATGTAACGACGCCAAGGTTC |