Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.057697 |
Chromosome: | chromosome 4 |
Location: | 2389913 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g221150 | GT90-5,GT90F5 | GT90 family protein 5; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAAATTAAAGGCATGCAAGCGCGGCGCG |
Internal bar code: | TTTGGCGTATATTCAAGCGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 639 |
LEAP-Seq percent confirming: | 99.5517 |
LEAP-Seq n confirming: | 2665 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTATCCAGTACAGGCGGT |
Suggested primer 2: | GCGTTTCCTTACTGCTCGAC |