| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.057782 |
| Chromosome: | chromosome 10 |
| Location: | 6431165 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g465900 | CDKA1 | Cyclin-dependent kinase; (1 of 4) K02206 - cyclin-dependent kinase 2 (CDK2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACTCCACCCCCGTGGACATCTGGTCCAT |
| Internal bar code: | TTTGGGTGCGTGACCCGTGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 639 |
| LEAP-Seq percent confirming: | 98.9143 |
| LEAP-Seq n confirming: | 1731 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACATGAACAGGTGGAGG |
| Suggested primer 2: | GGTGAGGCAGTTTTGAGAGC |