Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.057835 |
Chromosome: | chromosome 12 |
Location: | 7585717 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g555150 | NUOB10 | (1 of 1) IPR020163 - Complex I subunit NDUFS6; NADH:ubiquinone oxidoreductase 17.8 kDa subunit | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCGACGTGCCCCCGCTGCCCCGAACCTC |
Internal bar code: | AGATATACGCTGTGGTGCGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 663 |
LEAP-Seq percent confirming: | 98.2827 |
LEAP-Seq n confirming: | 1488 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAATTTCAGCCTCGTTCAGC |
Suggested primer 2: | GAACGCAAAATCTTTCTCGC |