Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.057878 |
Chromosome: | chromosome 12 |
Location: | 2843384 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g502350 | HEL50 | (1 of 1) K10899 - ATP-dependent DNA helicase Q1 [EC:3.6.4.12] (RECQL); DEAD/DEAH box DNA/RNA helicase, related to RECQ1 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATATGCTTCCGCGTCCGTGTGCCTCCAGG |
Internal bar code: | GGGGGATGTTAATTCGGCGGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 334 |
LEAP-Seq percent confirming: | 98.1612 |
LEAP-Seq n confirming: | 5018 |
LEAP-Seq n nonconfirming: | 94 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACCTGCCGCTAGCTTCCTA |
Suggested primer 2: | GAGCGCCTAACACTCCAGTC |