| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.057931 |
| Chromosome: | chromosome 2 |
| Location: | 89660 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g073850 | CGL54,LPA19 | (1 of 1) PTHR34041//PTHR34041:SF3 - FAMILY NOT NAMED // PHOTOSYSTEM II D1 PRECURSOR PROCESSING PROTEIN PSB27-H2, CHLOROPLASTIC; homolog of Low Photosystem II Accumulation 19 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGGCTAGCGGCGCTTCTGAGGCTGAGGT |
| Internal bar code: | AGAGCACTACAGTCCATCCGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 994 |
| LEAP-Seq percent confirming: | 99.7843 |
| LEAP-Seq n confirming: | 12952 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCAGCATCAGTGGGAAGTT |
| Suggested primer 2: | GGCAGACTCAGCAAACATGA |