| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.057938 |
| Chromosome: | chromosome 1 |
| Location: | 3330200 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g020950 | (1 of 1) K14852 - regulator of ribosome biosynthesis (RRS1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGATGGAGGCCGTGGAGATGCCGGCCAG |
| Internal bar code: | CTCGGTTGGGATTTCCGTTCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 775 |
| LEAP-Seq percent confirming: | 99.5937 |
| LEAP-Seq n confirming: | 11766 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGCTCCCTCACATTCACC |
| Suggested primer 2: | TTCATGACACCACACAGCCT |