Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.058000 |
Chromosome: | chromosome 7 |
Location: | 1688022 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g325550 | KDG3 | Diacylglycerol kinase; (1 of 2) K00901 - diacylglycerol kinase (ATP) (dgkA, DGK) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGAGTCGTGCTCCATGTACGTGCATATG |
Internal bar code: | TTCTCAGGGTCCCGTTCGCGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 803 |
LEAP-Seq percent confirming: | 93.9024 |
LEAP-Seq n confirming: | 308 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGAGCCACCTTTCTTGTCG |
Suggested primer 2: | GGAACATCACTGTCACCACG |