| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.058027 |
| Chromosome: | chromosome 12 |
| Location: | 4193556 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518550 | FAP54,C1d-HC1 | Flagellar central pair-associated protein 54; (1 of 1) PF14858 - Domain of unknown function (DUF4486) (DUF4486) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCAGCTGCAGATGCATCAAGCGGCGCAA |
| Internal bar code: | GCCGCATTTTCGAGATTCAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 205 |
| LEAP-Seq percent confirming: | 99.8326 |
| LEAP-Seq n confirming: | 1193 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTAGGTAAGCAGTGCGAGC |
| Suggested primer 2: | CGTCCTTCTTCTTGTCGTCC |