Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.058042 |
Chromosome: | chromosome 10 |
Location: | 2394911 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g435300 | AAP1 | Aspartyl aminopeptidase-like protein; (1 of 1) 3.4.11.21 - Aspartyl aminopeptidase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCATGGACGTGGCCCTATTGGCGATGAC |
Internal bar code: | GTATGCGTCAACCCTCGGCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 532 |
LEAP-Seq percent confirming: | 99.366 |
LEAP-Seq n confirming: | 5799 |
LEAP-Seq n nonconfirming: | 37 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTTGGAGCAAGCAGAGGTT |
Suggested primer 2: | GTCTCAACTTCTTGGCTCGG |