| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.058134 |
| Chromosome: | chromosome 10 |
| Location: | 4886180 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g454500 | 3'UTR | ||
| Cre10.g454550 | COX19 | (1 of 1) K18183 - cytochrome c oxidase assembly protein subunit 19 (COX19); Mitochondrial cytochrome c oxidase assembly protein | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAACACCCCCGCATGAGGGATCCAGATG |
| Internal bar code: | GTGTACTGCGGTACGTGCGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 960 |
| LEAP-Seq percent confirming: | 98.9693 |
| LEAP-Seq n confirming: | 4225 |
| LEAP-Seq n nonconfirming: | 44 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTACGTCAAGCCCCCATA |
| Suggested primer 2: | TGTGTCTTGTCCCGTCATGT |