Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.058159 |
Chromosome: | chromosome 12 |
Location: | 2574078 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g505300 | (1 of 1) PF08317 - Spc7 kinetochore protein (Spc7) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCCTCTCTTTGGGGGAGAATGAGCAGGA |
Internal bar code: | GAGCCGGCTGCTAGTCACAAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 909 |
LEAP-Seq percent confirming: | 99.301 |
LEAP-Seq n confirming: | 2131 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAATGGCAGCTTCAACTTCA |
Suggested primer 2: | GCCATGGGACTCTTACCTCA |