| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.058214 |
| Chromosome: | chromosome 12 |
| Location: | 5620324 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g532151 | ERM7 | (1 of 13) PTHR13018//PTHR13018:SF5 - PROBABLE MEMBRANE PROTEIN DUF221-RELATED // PHOSPHATE METABOLISM PROTEIN 7; ERD4-related membrane protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAAACGGGTCGCATGCATGCATGCAACC |
| Internal bar code: | GCGGCATCGCACTCGAAGTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 119 |
| LEAP-Seq percent confirming: | 87.3016 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCCGCTCCTACTTGTGAG |
| Suggested primer 2: | GTGGTAGTGGACAACCTGCC |