| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.058276 |
| Chromosome: | chromosome 5 |
| Location: | 289170 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g233550 | CBC1 | (1 of 7) 2.7.10.2//2.7.12.1 - Non-specific protein-tyrosine kinase / Cytoplasmic protein tyrosine kinase // Dual-specificity kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCACATTCCATTAGGGCGCCATGGATTGAT |
| Internal bar code: | GGACCTTGGGCACGAGGTAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 861 |
| LEAP-Seq percent confirming: | 99.683 |
| LEAP-Seq n confirming: | 8490 |
| LEAP-Seq n nonconfirming: | 27 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATTAGGGTTTCAGGTGCG |
| Suggested primer 2: | GCAGCGGTTTGGTTTGTATT |