| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.058327 |
| Chromosome: | chromosome 6 |
| Location: | 5372959 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g283634 | (1 of 1) PTHR14304:SF11 - PROTEIN LST-3, ISOFORM A | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTAAGTGTGCAGCTTTTTGGCGGTGGCTT |
| Internal bar code: | GACCAGCCTGTTGATCGAGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 548 |
| LEAP-Seq percent confirming: | 99.6691 |
| LEAP-Seq n confirming: | 12348 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCACCTGCATCTTCAAGCA |
| Suggested primer 2: | CTTGACTCTCCTCTGTCGCC |