| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.058382 |
| Chromosome: | chromosome 1 |
| Location: | 115397 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g000850 | CPLD38 | (1 of 1) PF11460 - Protein of unknown function (DUF3007) (DUF3007); cytochrome b6f biogenesis protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCTTTTTGCTTGTAGCCCTGCCCAGTC |
| Internal bar code: | GTGGTCGGACGTACCATTTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 460 |
| LEAP-Seq percent confirming: | 99.3952 |
| LEAP-Seq n confirming: | 493 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATGCGCTCTACTACGGGCT |
| Suggested primer 2: | CTTATCGCCGCTCAAAAGAC |